В частности, в исследовании Yoshikawa et al., включающем генетическое типирование штаммов из Бангладеша, Германии, Японии, Пакистана и Таиланда, было показано

Федеральное государственное бюджетное образовательное учреждение высшего образования «Северо-Западный государственный медицинский университет имени И.И.Мечникова» Министерства здравоохранения Российской Федерации

Кафедра эпидемиологии,
паразитологии и дезинфектологии
Направление подготовки 32.04.01
Общественное здравоохранение

Факторы риска заражения Blastocystis spp.
Выполнила Домбровская Диана Анатольевна

Научный руководитель
канд. мед. наук, доцент
Гончаров А.Е.
«Допустить к защите
Зав. кафедрой
З.д.н., д.м.н.,
профессор Зуева Л.П.
__________________________
(подпись)
«______»_____________2016 г.
Санкт-Петербург
2016



ОГЛАВЛЕНИЕ
13 TOC \o "1-3" \h \z \u 1413 LINK \l "_Toc455735023" 14ВВЕДЕНИЕ 13 PAGEREF _Toc455735023 \h 1431515
13 LINK \l "_Toc455735024" 14ГЛАВА 1 БЛАСТОЦИСТНАЯ ИНВАЗИЯ (ОБЗОР ЛИТЕРАТУРЫ) 13 PAGEREF _Toc455735024 \h 14101515
13 LINK \l "_Toc455735025" 141.1 Современное представление о бластоцистной инвазии. 13 PAGEREF _Toc455735025 \h 14101515
13 LINK \l "_Toc455735026" 141.2. Клиническое значение. 13 PAGEREF _Toc455735026 \h 14121515
13 LINK \l "_Toc455735027" 141.3. Эпидемиологическое значение бластоцистной инвазии 13 PAGEREF _Toc455735027 \h 14131515
13 LINK \l "_Toc455735028" 141.4. Факторы риска заражения Blastocystis spp. 13 PAGEREF _Toc455735028 \h 14151515
13 LINK \l "_Toc455735029" 141.5. Лабораторная диагностика 13 PAGEREF _Toc455735029 \h 14161515
13 LINK \l "_Toc455735030" 14ГЛАВА 2 МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ 13 PAGEREF _Toc455735030 \h 14191515
13 LINK \l "_Toc455735031" 142.1. Общая характеристика исследования 13 PAGEREF _Toc455735031 \h 14191515
13 LINK \l "_Toc455735032" 142.2. Характеристика обследованных лиц 13 PAGEREF _Toc455735032 \h 14191515
13 LINK \l "_Toc455735033" 142.3. Сбор, транспортировка и хранение материала 13 PAGEREF _Toc455735033 \h 14201515
13 LINK \l "_Toc455735034" 142.4. Идентификация Blastocystis spp. 13 PAGEREF _Toc455735034 \h 14211515
13 LINK \l "_Toc455735035" 142.5. Внутривидовое генетическое типирование Blastocistys .sp. 13 PAGEREF _Toc455735035 \h 14221515
13 LINK \l "_Toc455735036" 142.6. Анкетирование исследуемой группы 13 PAGEREF _Toc455735036 \h 14241515
13 LINK \l "_Toc455735037" 142.7. Определение основных компонентов кишечной микробиоты с использованием тест-систем «Колонофлор-16» и «Прото-скрин» 13 PAGEREF _Toc455735037 \h 14241515
13 LINK \l "_Toc455735038" 142.9. Статистическая обработка результатов 13 PAGEREF _Toc455735038 \h 14241515
13 LINK \l "_Toc455735039" 14ГЛАВА 3. РЕЗУЛЬТАТЫ СОБСТВЕННЫХ ИССЛЕДОВАНИЙ 13 PAGEREF _Toc455735039 \h 14251515
13 LINK \l "_Toc455735040" 143.1. Сравнительная оценка санитарно-эпидемиологического благополучия в Чукотском автономном округе и Санкт-Петербурге 13 PAGEREF _Toc455735040 \h 14251515
13 LINK \l "_Toc455735041" 143.2. Характеристика обследованных больных 13 PAGEREF _Toc455735041 \h 14321515
13 LINK \l "_Toc455735042" 143.3. Результаты обследования популяции ЧАО и СПб на бластоцистную инвазию. 13 PAGEREF _Toc455735042 \h 14331515
13 LINK \l "_Toc455735043" 143.4. Результаты генетического типирования. 13 PAGEREF _Toc455735043 \h 14381515
13 LINK \l "_Toc455735044" 143.5. Результаты исследования факторов риска. 13 PAGEREF _Toc455735044 \h 14401515
13 LINK \l "_Toc455735045" 14ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ ИССЛЕДОВАНИЙ 13 PAGEREF _Toc455735045 \h 14451515
13 LINK \l "_Toc455735046" 14ВЫВОДЫ: 13 PAGEREF _Toc455735046 \h 14491515
13 LINK \l "_Toc455735047" 14СПИСОК СОКРАЩЕНИЙ 13 PAGEREF _Toc455735047 \h 14501515
13 LINK \l "_Toc455735048" 14СПИСОК ЛИТЕРАТУРЫ 13 PAGEREF _Toc455735048 \h 14511515
15

ВВЕДЕНИЕ
Актуальность темы исследования.
Из года в год на территории Российской Федерации сохраняется напряженная ситуация по инфекционным кишечным заболеваниям. За последние десять лет отмечается тенденция к увеличению заболеваемости инфекциями этой группы. Среди острых кишечных инфекций (ОКИ) значительным остается процент острых кишечных инфекций с неустановленной этиологией (ОКИНЭ). На долю ОКИНЭ приходится порядка 63-65% от всех ОКИ. По данным государственного доклада Роспотребнадзора «О состоянии санитарно-эпидемиологического благополучия населения в Российской Федерации в 2014 году» острые кишечные инфекции неустановленной этиологии занимают третье место по экономической значимости, уступая лишь туберкулезу и острым респираторным инфекциям. Ущерб, нанесенный ОКИ неустановленной этиологии в 2014 году, оценивается в 12,8 миллиардов рублей. Сложившаяся ситуация указывает на сохраняющуюся высокую активность путей передачи - водного, пищевого и контактно-бытового. Эти пути передачи являются общими для возбудителей вирусной, бактериальной и паразитарной природы. Таким образом, помимо классических патогенов, хорошо известных и эффективно выявляемых, свой потенциал к эпидемическому распространению получают новые или малоизвестные агенты. Одним из таких малоизученных патогенов является Blastocystis spp. - возбудитель бластоцистоза.
Бластоцистоз – паразитарное заболевание, вызываемое простейшими Blastocystis spp. (бластоцисты). Бластоцисты – род одноклеточных, эукариотических микроорганизмов, паразитирующих в толстом кишечнике человека и животных.
Микроорганизм известен с начала ХХ века, когда впервые в 1911 году был описан Alexieff. В 1912 год Brumpt выделил и идентифицировал бластоцисты в материале от человека. На протяжении длительного периода времени микроорганизм расценивался как комменсал, не имеющий значительного медицинского значения. В последние годы ситуация изменилась, так как стало появляться все больше данных о связи Blastocystis spp. с заболеваниями желудочно-кишечного тракта [64]. В настоящее время активно дискутируется вопрос об этиологической роли бластоцистной инвазии в развитии острых и хронических кишечных расстройств, синдрома раздраженного кишечника, а так же внекишечных заболеваний (дерматозы) [10,46].
По некоторым оценкам порядка одного миллиарда человек на Земле инфицированы Blastocystis spp. [57]. Инвазия имеет убиквитарных характер, то есть встречается повсеместно, однако превалентность распределена не равномерно и может быть низкой в таких странах как Япония (0,5 до 1%) и Сингапур (3,3%) и высокой в развивающихся странах: Аргентина (27,2%), Бразилия (40,9%), Куба (38,5%), Египет (33,3%), Индонезия (60%) [64].
О проявлениях эпидемического процесса бластоцистоза на территории России можно судить, опираясь лишь на небольшое количество исследований. В исследовании, проведенных Н.М. Коза и соавторами в 1997–2001 гг. в Перми, бластоцистная инвазия выявлена в 13,1% случаев [7]. В Омске по результатам однократных обследований населения в 1999–2001 гг. частота обнаружения Blastocystis spp. у здоровых составляла от 0,9 до 2,3% [15]. В Санкт-Петербурге, в исследовании А.С. Сигидаева и соавторов, было проведено обследование лиц с хроническим вирусным гепатитом, показатель превалентности составил 28,8%, у лиц с другими заболеваниями желудочно-кишечного тракта – 5,5% [13].
Данные различных работ указывают на ряд потенциальных факторов риска: социально-экономическое неблагополучие, контакт с зараженными животными, употребление контаминированной воды и пищи, иммиграция и путешествия в тропические страны [64]. Так же предполагается, что к группам риска относятся лица страдающие от хронического вирусного гепатита В, ВИЧ-инфицированные и лица с иммунодефицитом.
Оценки эпидемиологической обстановки по бластоцистозу на территории России препятствует отсутствие достаточного количества эпидемиологических исследований. Диагностика, группы риска, пути передачи, профилактические мероприятия – актуальные вопросы, которые на сегодняшний день остаются открытыми. Исследование различных популяций, проживающих на территориях с выраженными климатическими, социальными, экономическими и санитарно-гигиеническими особенностями может помочь в выявлении некоторых закономерностей в эпидемиологии возбудителей инфекционных заболеваний.
Степень разработанности темы.
За последние десять лет проблема бластоцистной инвазии приобрела широкий интерес среди множества исследователей различных стран мира. На сегодняшний день база данных научных публикаций PubMed насчитывает более 1200 наименований работ посвященных проблеме. В научной литературе достаточно полно проработаны вопросы, касающиеся биологических свойств Blastocystis, но в тоже время открытыми остаются важные медицинские вопросы. В частности не решенными остаются вопросы клинической значимости микроорганизма и его эпидемиологии. Если в дискуссии об этиологической роли микроорганизма в развитии острой кишечной инфекции достигнут консенсус, то влияние хронической инвазии активно обсуждается. Оценку клинического значения хронической инвазии в значительной степени затрудняют противоречивые результаты исследований. Так ряд авторов указывают на связь бластоцистной инвазии с синдромом раздраженного кишечника (СРК) и кожными заболеваниями, такими как атопический дерматит и крапивница и настаивают на патогенности микроорганизма [10,22,46]. С другой стороны существуют данные, демонстрирующие возможную профилактическую роль Blastocystis в отношении воспалительных заболеваний кишечника – болезнь Крона и неспецифический язвенный колит (НЯК). Авторы этой работы рассматривают возможность применения культур Blastocystis в качестве пробиотического препарата [41]. Помимо этого, до сих пор остается значительный пробел в понимании эпидемиологических особенностей бластоцистной инвазии. Основываясь на имеющихся на сегодняшний день результатах эпидемиологических исследований, можно предполагать, что эпидемиологические особенности бластоцистной инвазии не имеют универсального характера и варьируют от региона к региону. Данные по эпидемиологии бластоцисной инвазии в Российской Федерации немногочисленны и имеют отрывочный характер, что препятствует адекватной оценке ситуации сложившийся на территории страны.

Цель исследования - провести эпидемиологическую оценку широкого спектра социальных, поведенческих и биологических факторов риска инфицирования Blastocystis spp. в географически дистантных популяциях (Чукотский полуостров, Санкт-Петербург).
Задачи исследования:
провести сравнительную оценку санитарно-эпидемиологического благополучия в Чукотском автономном округе и Санкт-Петербурге по данным отчетной документации управлений Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека;
определить превалентность бластоцистной инвазии в различных группах населения с использованием метода полимеразной цепной реакции;
установить распространенность отдельных субтипов, провести внутривидовое генетическое типирование выявленных штаммов;
провести анкетирование исследуемой популяции для сбора информации о потенциальных факторах риска заражения бластоцистной инвазией;
установить потенциальные факторы риска инфицирования Blastocistis spp. в исследовании случай-контроль;
оценить возможную взаимосвязь между наличием бластоцистной инвазии и дисбиозом кишечника.

Положения, выносимые на защиту.
1. Бластоцистная инвазия представляет собой протозойную инвазию широко распространенную в различных по географическому, социально-экономическому, и демографическому положению регионов.
2. Субтипы бластоцист ST1, ST2, ST3 являются глобально распространенными.
3. Наличие дерматологических заболеваний в анамнезе статистически значимо связано с бластоцистной инвазией.

Научная новизна исследования.
В настоящей работе впервые было проведено исследование эпидемиологических особенностей бластоцистной инвазии на территории Чукотского Автономного Округа - территории специфической с социальной, экономической и санитарно-гигиенической точек зрения. Определена превалентность бластоцистной инвазии, а так же установлена распространенность отдельных субтипов бластоцист в изучаемых группах населения. Получены данные указывающие на возможную связь бластоцистной инвазии и кожных заболеваний.
Теоретическая и практическая значимость исследования.
Теоретическая значимость результатов работы заключатся в дополнении знаний о распространенности различных генетических субтипов Blastocystis spp., циркулирующих на территории Российской Федерации. Данные, полученные в исследовании, указывающие на связь инвазии с кожными заболеваниями, возможной связью с вирусными гепатитами и дисбиозом кишечника, в очередной раз подчеркивают клиническую значимость микроорганизма, а так же указывают на целесообразность дальнейших исследований патогенеза бластоцистной инвазии.
С практической точки зрения выводы, полученные в результате работы могут быть учтены при разработке профилактических мероприятий и организации эпидемиологического надзора за бластоцистной инвазией.

Дизайн и методы исследования.
В качестве дизайна исследования для выявления потенциальных факторов риска был выбран дизайн – «случай-контроль». Выбор дизайна исследования обоснован тем, что в качестве вероятных факторов риска рассматривалось одновременно множество факторов, таких как социальный и экономический статус, туризм, наличие различных хронических заболеваний, контакт с животными, употребление недоброкачественной воды и пищи. Сбор информации осуществлялся наиболее доступным способом – посредствам анкет-опросников, заполняемыми участниками исследования.
Идентификация Blastocystis spp. в клиническом материале производилась методом полимеразной цепной реакции с родоспецифическими праймерами. Выбор ПЦР в качестве основного метода идентификации обусловлен в первую очередь более высокой по сравнению с микроскопией чувствительностью, а так же тем фактом что, при транспортировке образцов из Чукотского АО и последующем хранении образцы могли быть многократно подвержены воздействию резких перепадов температур, оказывающих разрушительное воздействие на структуры микроорганизма. При таких условиях микроскопический метод в большей степени подвержен снижению чувствительности, чем ПЦР идентификация. Определение принадлежности выявленных штаммов Blastocystis так же проводилось с помощью полимеразной цепной реакции со субтипспецифическими праймерами. Для части штаммов было проведено секвенирование фрагмента ДНК малой рибосомальной субъединицы SSUrDNA, так называемого Barcode-участка, имеющего филогенетическое значение.


Внедрение результатов исследования.
Результаты работы могут быть использованы при разработке методических рекомендаций для врачей-эпидемиологов, паразитологов, инфекционистов, врачей клинической лабораторной диагностики по профилактике кишечных протозойных инвазий, разрабатываемых кафедрой эпидемиологии, паразитологии и дезинфектологии СЗГМУ им. И.И. Мечникова. Материалы работы будут использованы в учебном процессе.
Структура и объем диссертации.
Диссертационная работа состоит из введения, обзора литературы, материалов и методов исследования, результатов собственных исследований и обсуждения полученных результатов, выводов и списка цитируемой литературы. Работа изложена на 55 страницах машинописного текста, содержит 13 таблиц, 9 рисунков. В работе использованы 15 отечественных и 60 иностранных источников литературы.


ГЛАВА 1 БЛАСТОЦИСТНАЯ ИНВАЗИЯ (ОБЗОР ЛИТЕРАТУРЫ)
1.1 Современное представление о бластоцистной инвазии.
Бластоцистоз – паразитарное заболевание, вызываемое простейшими Blastocystis spp. (бластоцисты). Бластоцисты – род одноклеточных, эукариотических микроорганизмов, паразитирующих в толстом кишечнике человека и животных. Бластоцисты распространены повсеместно и являются одним из наиболее часто выявляемых организмов при паразитологических исследованиях [64]. Предположительно порядка одного миллиарда человек в мире инвазировано бластоцистами [54].
Первые описания бластоцист появились в начале ХХ века. Впервые микроорганизм был описан Alexieff в 1911 году. В 1912 году Brumpt выделил и идентифицировал бластоцисты в материале от человека [24].
Известны четыре морфологические формы бластоцист: вакуолярная, гранулярная, цистная и амебоидная. Вакуолярные формы наиболее часто встречаются при паразитологических исследованиях в лабораторных культурах. Они имеют сферическую форму, размеры варьируют от 2 до 200 мкм [59]. Цитоплазма содержит органеллы, характерные для эукариотических клеток, несколько ядер, оттесненных центральной вакуолью к периферии. Центральная вакуоль обычно содержит различный материал – гранулы или хлопьевидный материал различной степени плотности. Цистная форма характеризуется многослойной клеточной стенкой и малым размером центральной вакуоли с 1-4 ядрами [44]. Гранулярная (зернистая) форма характеризуется наличием внутриклеточных гранул, является регулярно наблюдаемой формой, преимущественно в лабораторных культурах. Амебоидная форма – амебоподобные клетки меняющейся формы с псевдоподиальным выпячиванием цитоплазмы встречается редко и только в образцах от больных с диарей. Обнаружение амебоидной форма паразита в клиническом материале может рассматриваться в качестве индикатора патогенности [12]. Содержит различные вакуоли с бактериями и без них, а также трудно дифференцируемые ядра [9].
Заражение человека и животных осуществляется цистами, которые развиваются в вакуолярную форму в толстом кишечнике. Вакуолярная форма делится митозом и может развиться в амебиоидную либо в гранулярную форму. Из вакуолярных форм так же формируются цисты, которые могут попадать в окружающую среду и инфицировать нового хозяина.
Первоначально бластоцисты ошибочно классифицировались как грибки, дрожжи и даже цисты Trichomonas spp., их относили к различным классам простейших [73]. В 1996 году, на основании анализа полной последовательности гена кодирующего малую субединицу рибосомальной РНК (SSU-rDNA), была установлена принадлежность микроорганизма к царству Stramenopiles, включающего одноклеточные и многоклеточные водоросли [52]. Современное систематическое положение бластоцист - царство Stramenopiles, подцарство Chromobiota, подтип Opalinata, класс Blastocystea, отряд Blastocystida, семейство Blastocystidae, род Blastocystis [16]. Род Blastocystis – единственный известный на сегодняшний день представитель царства Stramenopiles, паразитирующий в организме человека и других млекопитающих.
Представители Blastocystis spp., выделяемые от человека и животных, не имеют значительных морфологических различий [53,60,61,71]. Однако молекулярно-биологические исследования показали чрезвычайно широкое генетическое разнообразие представителей рода. На сегодняшний день известно 17 генетических субтипов бластоцист [70]. Установлено, что в организме людей встречаются субтипы с первого по девятый (ST1-ST9), при этом третий субтип считается преимущественно антропонозным, а остальные зоонозными. Ранее существовавшее мнение о видоспецифическом паразитизме бластоцист оказалось не верным. В связи с этим были предложены изменения в номенклатуре, было решено отказаться от видовых названий в пользу обозначения генетического субтипа, штамма. Согласно современной классификации используется название Blastocystis species subtype n., где n – число, указывающее субтип микроорганизма. Ранее употребляемый термин – «Blastocystis hominis» в настоящее время считается устаревшим [57].
1.2. Клиническое значение.
Вопрос о клиническом значении бластоцистной инвазии на сегодняшний день остается открытым. Течение инвазии может значительно варьировать по степени клинической выраженности от бессимптомного носительства до острых профузных диарей.
Как правило бластоцистоз проявляется такими неспецифическими симптомами как тошнота, рвота, потеря веса, боли в животе, вздутие, метеоризмы, может протекать как острая или хроническую диарея. Самыми распространнеными симптомами у больных являются боли в животе и понос [28,37]. Вероятно, что у пациентов с бластоцистная инвазия могут быть следующие симптомы: зуд [32], прямокишечное кровотечение [30], эозинофилия [33], спленомегалия и гепатомегалия [29].
Часто бластоцисты определяются у лиц, не имеющих каких-либо жалоб со стороны желудочно-кишечного тракта. С другой стороны, в исследованиях показана связь бластоцистной инвазии с острыми и хроническими кишечными расстройствами, с синдромом раздраженного кишечника (СРК) [22,31,69], внекишечными заболеваниями, в частности дерматозами и аллергические заболеваниями [19,34,75]. Так в результате проведения систематического обзора и мета-анализа 11 опубликованных исследований связи бластоцистной инвазии и синдрома раздраженного кишечника, включающего в общей сложности 1728 пациентов с СРК и 1292 пациента контрольной группы, было показано, что относительный риск развития СРК у инвазированых составляет 2.34 (ДИ 95% 1,82 – 3,00, p = 0,001) [46].
Интересно, что множество исследований также свидетельствуют о причинно-следственной связи между Blastocystis и кожными поражениями [17, 36, 43, 66]. В этих исследованиях, присутствие паразита было зафиксировано у пациентов с острой или хронической крапивницей [17, 36, 66], отеком Квинке [43]. Лечение паразита приводит к исчезновению и инфекции, и кожных повреждений.
У больных хроническими дерматозами выявлена высокая частота встречаемости паразитозов, среди которых доминирующее положение занимают простейшие Blastocystis spp. Инвазированность бластоцистами пациентов с атопическим дерматитом составляет 89,5%, артропатическим псориазом – 81,5%, вульгарным псориазом – 79,8%, экземой – 71,7%, красным плоским лишаем – 67,7% и микробной экземой – 62,3% и нарастает с увеличением возраста больных и продолжительности заболевания. В период обострения заболевания, по сравнению с ремиссией, повышается не только частота встречаемости Blastocystis spp., но и их вирулентность, а также резистентность к антипротозойным препаратам [10].
Необходимость лечения лиц, не имеющим клинических проявлений и с небольшим количеством цист, является спорной [18, 27]. В случаях, когда лечение является оправданным, то обычно используется метронидазол в качестве терапии первой линии. Если метронидазол не является эффективным, обычно используется либо Ко-тримоксазол или нитазоксанид в качестве терапии второй линии [25]. 
В настоящее время есть ряд исследований, указывающих на связь бластоцистной инвазии с дисбиотическими изменениями кишечника [2, 4].
1.3. Эпидемиологическое значение бластоцистной инвазии
Заболеваемость бластоцистозом значительно варьирует в разных странах и популяциях.
Отмечено, что в развивающихся странах превалентность выше, чем в развитых, что связывают с более низким санитарно-гигиеническим уровнем, контактом с зараженными животными, употреблением контаминированной воды и пищи. Показана относительно низкая пораженность бластоцистозом в таких странах как Сингапур (3,3%) и Япония (0,5 до 1%) и высокая в таких развивающихся странах как Индонезия (60%), Бразилия (40,9%), Куба (38,5%),Египет (33,3%), Аргентина (27,2%) [64].
На сегодняшний день бластоцистная инвазия на территории России не подлежит регистрации, не входит в формы государственной статистической отчетности. О проявлениях эпидемического процесса бластоцистоза можно судить, опираясь лишь на небольшое количество превалентных исследований.
В исследованиях, проведенных Н.М. Коза и соавторами в 1997–2001 гг. в Перми, бластоцистная инвазия выявлена в 13,1% случаев [7]. В Омске по результатам однократных обследований населения в 1999–2001 гг. частота обнаружения Blastocystis у здоровых составляла от 0,9 до 2,3% [15].
В исследовании А.С. Сигидаева и соавторов показано, что годовая динамика выявления бластоцист в испражнениях людей имела подъем в летний период с пиками в июле и августе. По мнению авторов это связано с тем, что на летний период приходится основная пора отпусков, усиливаются миграционные процессы, увеличивается употребление фруктов и овощей, а также контакт с почвой (работы на садовых участках и огородах). Данных о возрастной структуре заболеваемости на сегодняшний день нет [13].
В ряде исследований освещаются вопросы географического распространения заболеваемости бластоцистозом, определяемом различными субтипами. В частности, в исследовании Yoshikawa et al., включающем генетическое типирование штаммов из Бангладеша, Германии, Японии, Пакистана и Таиланда, было показано, что для четырех географически удаленных популяций, исключая Тайланд, субтип 3 является преобладающим (92,3%), за ним следуют субтип 1 (от 7,7 до 25%) и 6 (от 10 до 22,9%) [70].
Похожая внутривидовая структура описана в Сингапуре (78% субтип 3 и 22% субтип 1) [68], в Китaе (60.4% субтип 3 и 24.5% субтип 1) [40], Греции (60% субтип 3 и 20% субтип 1) [42], Германии (54% субтип 3 и 21% субтип 1) [21] и Турции (75.9% субтип 3) [48]. Таким образом, субтипы Blastocystis sp. 1-3 являются преобладающими в глобальной структуре данного возбудителя.
1.4. Факторы риска заражения Blastocystis spp.
В качестве факторов риска бластоцистной инвазии в литературе рассматриваются иммунодефицитные состояния, контакт с животными, низкий санитарный и гигиенический уровень, употребление недоброкачественной воды, иммиграция и путешествия в тропические страны, контакт с почвой. Большое число превалентных исследований рассматривает водный путь распространения бластоцистной инвазии как ведущий, обусловленный контаминацией воды устойчивыми к неблагоприятным воздействиям цистами.
При паразитологическом обследовании коллективов тайской армии наибольшее число находок пришлось на бластоцисты, превалентность составила 21,9% [62].Такой высокий процент пораженности был достоверно связан с употреблением нефильтрованной, некипяченой воды.
В исследовании внутривидовой структуры бластоцист с применением ПЦР генотипирования с STS праймерами среди 238 случайно выбранных жителей сельской местности Китая параженность составила 32,6%. При этом инфицирование субтипом 1 было ассоциировано с употреблением сырой родниковой воды, в то время как инфицирование субтипом 3 было ассоциировано с употреблением некипяченой воды централизованного водоснабжения [40].
Возможность водного пути распространения возбудителя обусловлена устойчивостью цист к неблагоприятным факторам внешней среды. В воде цисты могут оставаться жизнеспособными до 19 дней, однако чувствительны к замораживанию, нагреванию и дезинфектантам [72]. Yoshikawa показано, что цисты могут выживать до одного месяца при температуре 25°C и до двух месяцев при 4°C [45].
Blastocystis инфекции широко распространены среди представителей определенных профессий, в том числе, предполагающих контакт с животными, что в ряде случаев доказывает зоонозную природу организма. Отмечена высокая заболеваемость бластоцистозом рабочих, ухаживающих за животными в зоопарках и работников скотобоен [49, 50]. В исследованиях [26, 38] указывается, что работники общепита также являются группой риска.
Также известно, что высокая пораженность Blastocystis ассоциирована с различными хроническими заболеваниями, в том числе с аллергическими заболеваниями кожи [10, 47] ВИЧ-инфекцией [39, 23], хроническими вирусными гепатитами [13].
Дети также могут представлять собой группу риска [63].
1.5. Лабораторная диагностика
Микроскопия. Для диагностики бластоцистной инвазии применяют ряд диагностических методов, на первом месте из которых стоит микроскопия нативного мазка. В настоящее время существуют методы окрашивания мазка раствором Люголя, трихромом, по Романовскому – Гимзе. Метод является наиболее доступным, простым и в тоже время достоверным. Однако классическая вакуолярная форма зачастую не является преобладающей в каловых массах, в тоже время мелкие цисты тяжело идентифицировать (имеют сходство с каплями жира и Cyclospora sp., дрожжами). Клинические проявления инвазии отмечается при обнаружении более пяти паразитов в поля зрения при Х400 увеличении в мазке фекалий [56].
Метод обогащения. Также в литературе описан метод обогащения, направленный на концентрацию цист бластоцист в осадке. В основе метода формалин-эфирной обогащения лежит разность удельного веса используемых химических реактивов и цист Blastocystis spp., в результате чего они скапливаются в осадке. Данный метод не увеличивает чувствительность прямой микроскопии, обладает низкой чувствительностью по сравнению с ПЦР, методом трихромного окрашивания мазков и культуральным методом [55, 58]. Имеются данные о разрушении и деформации бластоцист при использовании данного метода [14].
Культуральная диагностика. Для культуральной диагностики используются среды Jones’ [35] или Boeck and Drbohlav’s [20], в отечественной научной литературе описана двухфазная питательная среда с коагулированным яичным белком и сывороткой крови животных, разработанная Беловой [1]. Отобранные образцы помещают на питательную среду и инкубируют в термостате в течение трех суток с последующей микроскопией. Показано, что субкультивирование бластоцист на специальных питательных средах позволяет увеличить чувствительность диагностики до уровня сопоставимого с ПЦР идентификацией [56, 65].
Молекулярно-генетические методы диагностики.
В настоящее время молекулярно-генетические методы детекции активно и используются в диагностике паразитарных инвазий, в частности бластоцистоза. Разработана методика идентификации возбудителя при помощи ПЦР диагностики с двумя парами праймеров к Barcode-участку SSUrDNA [51].
Использование субтип-специфических (STS) праймеров позволяет дифференцировать 7 основных субтипов Blastocystis sp.. Такой подход важен для эпидемиологических исследований, так как дает представление о распространении различных генотипов возбудителя среди популяций людей и животных. Отмечена высокая чувствительность и специфичность методов, основанных на применении полимеразной цепной реакции [54].
Изучение генетического полиморфизма возбудителя бластоцистной инвазии проводится также с испольщованием метода монолокусного секвенирования-типирования [54], анализа полиморфизма рестрикции ПЦР фрагментов (RFLP) [3].
Серологические исследования в настоящее время не используется для диагностики этой инфекции [ 74 ]. Иммунологические методы находятся в стадии разработки.
Многие лаборатории не регистрируют бластоцистную инвазию. Это связано с тем, что Blastocystis spp. имеют большое количество морфологических форм, что затрудняет диагностику при использовании метода микроскопии [13].























ГЛАВА 2 МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ
2.1. Общая характеристика исследования
Настоящее исследование – проспективное (по времени сбора данных и формированию выборки), динамическое (по временным параметрам) и обсервационное (наблюдательное), проводилось с января 2014 по июнь 2016 года. Объект исследования – популяция беременных женщин Чукотского АО и популяция больных с острым диарейным синдромом, проходивших лечение на кишечном отделении №27 городской инфекционной больницы им. С.П.Боткина г. Санкт-Петербурга. Предмет исследования - эпидемический процесс Blastocystis spp в исследуемых популяциях.
2.2. Характеристика обследованных лиц
При изучении факторов риска бластоцистной инвазии было обследовано две популяции.
В первую популяцию вошли 248 беременных женщин в возрасте от 14 до 44 лет, находившихся в Чаунской центральной районной больнице города Певек и в Чукотской окружной больнице города Анадырь с 01.2014 по 07.2015 на отделении акушерства и гинекологии.
Исследуемая популяция была разделена на 6 групп по административной принадлежности:
К I группе (n=136) были отнесены женщины, проживавшие в Анадырском районе ЧАО (54,8 %);
ко II группе (n=64) - женщины, проживавшие в Чукотском районе (25,8 %);
к III (n=19) - женщины, проживавшие в Билибинском района (7,8%);
к IV (n=13) группе были отнесены женщины из Провидеского района (5,2 %).;
к V (n=13) - из Иультинского района (5,2 %);
к VI (n=3) - из Чаунского района (1,2 %).
Информация о группах представлена в таблице №1.

Таблица №1 - Данные о группах пациентов, принявших участие в исследовании.
№ группы
Район
Количество участников в группе

1
Анадырский район
136

2
Чукотский район
64

3
Билибинский район
19

4
Провидеский район
13

5
Иультинский район
13

6
Чаунский район
3

Всего участников исследования:
247


Вторую популяцию составили пациенты с острым диарейным синдромом г. Санкт-Петербурга. Седьмая группа (далее Группа №7) - 345 пациентов кишечного отделения городской инфекционной больницы №30 им. С.П.Боткина в возрасте от 14 до 87 лет, поступивших в стационар с диагнозом гастроэнтероколит неустановленной этиологии. Пациенты находились в стационаре с сентября 2014 по июнь 2015 года
2.3. Сбор, транспортировка и хранение материала
От всех пациентов, задействованных в исследовании, были получены образцы клинического материала (кал). На пунктах сбора клинического материала образцы от обследуемых помещались в индивидуальные одноразовые чистые герметичные контейнеры.
Материал, полученный от беременных женщин Чукотски, хранился в условиях морозильных камер в ЛПУ, расположенных на территории Чукотского АО. Далее материал был доставлен авиатранспортом в лабораторию кафедры эпидемиологии, паразитологии и дезинфектологии СЗГМУ им. И.И.Мечникова в термоконтейнере с хладоэлементами при температуре +5±3оС. После доставки образцы были подвергнуты заморозке (-70 оС). Перед выделением ДНК нужное количество материала размораживалось при комнатной температуре в течение 30 минут. Выделение ДНК из всего материала проводилось с помощью коммерческого набора "ДНК-экспресс" ("Литех") в соответствии с протоколом, рекомендуемым производителем. Образцы выделенной ДНК хранились в холодильной камере при температуре -20 оС.
Материал, полученный от пациентов с острым диарейным синдромом г.Санкт-Петербурга, доставлялся в лабораторию кафедры эпидемиологии, паразитологии и дезинфектологии СЗГМУ им. И.И.Мечникова в день забора. В этом случае материал не подвергался заморозке. В противном случае, образцы хранились на пункте сбора при температуре -4оС от 2 до 7 дней. В лабораторию клинический материал транспортировался в термоконтейнере с хладоэлементами при температуре +5±3оС в течение, не более двух часов. После доставки образцов в лабораторию проводилась процедура выделение тотальной ДНК из клинического материала. Выделение ДНК проводилось с помощью коммерческого набора "ДНК-экспресс" ("Литех") в соответствии с протоколом, рекомендуемым производителем. Образцы выделенной ДНК хранились в холодильной камере при температуре -20 оС.
2.4. Идентификация Blastocystis spp.
Для идентификации Blastocystis spp. в клиическом материале был выбран подход, основанный на полимеразной цепной реакции. Выбор в пользу ПЦР идентификации был обусловлен необходимостью нивелирования потерь диагностической чувствительности связанных с длительной транспортировкой и хранением клинических образцов. Перепады температуры, особенно чередование замораживания и оттаивания, критически влияет на морфологическую целостность клеток микроорганизма, что в большей степени сказывается на чувствительности микроскопии, чем ПЦР.
В качестве метода ПЦР идентификации Blastocystis в образцах клинического материала, был выбран метод полимеразной цепной реакции с родоспецифическими праймерами к фрагменту SSUrDNA (рибосомальная ДНК малой субъединицы), так называемому Barcode-участку [51].
Последовательности праймеров:
BhRDr (5’-GAGCTTTTTAACTGCAACAACG-3’)
RD5 (5’-ATCTGGTTGATCCTGCCAGT-3’)
Электрофоретическая детекция в 1% агарозном геле. Условия амплификации: 39 циклов, включающих денатурацию при 94 оС – 60 сек., отжиг праймеров 59 оС - 40 сек., элонгация 72 оС – 60 сек. Размер ПЦР продукта – 600 п.о.
2.5. Внутривидовое генетическое типирование Blastocistys .sp.
Генетическое типирование положительных образцов проводилось методом полимеразной цепной реакции с субтипспецифическими праймерами [70]. Условия реакции: денатурация 94 оС - 60 сек., отжиг праймеров 56.5 оC 40 сек., элонгация 72 оС - 60 сек., 40 циклов. Детекция продуктов амплификации осуществлялась методом гель-электрофореза в 1% агарозном геле. Последовательности праймеров представлены в таблице №2.




Таблица №2 - Последовательности праймеров для генетического типирования Blastocystis spp.
Название амплифицируемой последовательности
Сутбип (ST)
Размер продукта п.о.
Последовательность праймеров

SB83
1
351
F- GAAGGACTCTCTGACGATGA
R- GTCCAAATGAAAGGCAGC

SB155
2
650
F- ATCAGCCTACAATCTCCTC
R- ATCGCCACTTCTCC
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
Для подтверждения результатов ПЦР-генотипирования дополнительно было проведено секвенирование Barcode-участков ДНК восьми случайным образом отобранных штаммов Blastocystis sp., отнесенных к 1,2 и 3 субтипам. Для этого методом полимеразной цепной реакции были получены ампликоны Barcode-участков этих штаммов, продукты реакции были разделены методом электрофореза в агарозном геле. Ампликоны, соответствующие размеру 600±20 п.о., были очищены из агарозного геля набором Cleanup Standard (Евроген, Москва) в соответствии с инструкцией производителя. Секвенирование было проведено в ООО «Евроген РУ» (Москва) с прямого и обратного праймера BhRDr и RD5, соответственно. Анализ нуклиотидных последовательностей проводился с помощью онлайн базы данных PubMLST. Множественное выравнивание полученных нуклеотидных последовательностей и построение диаграммы филогенетических расстояний – филограммы было проведено в программе MEGA 6.06.
2.6. Анкетирование исследуемой группы
Всем пациентам предлагалось заполнить опросник, включающий вопросы, направленные на выявления потенциальных факторов риска (употребляемая пища, место жительства, наличие некоторых хронических заболеваний, профессиональные факторы, миграция, уровень образования, оценивался водный фактор и т.д.). Содержание опросников приведено в приложении 1.
2.7. Определение основных компонентов кишечной микробиоты с использованием тест-систем «Колонофлор-16» и «Прото-скрин»
Положительные на наличие бластоцист пробы, выявленные в популяции беременных женщин из Чукотского автономного округа, были дополнительно исследованы тест-системами «Колонофлор-16» и «Прото-скрин» («АльфаЛаб», Санкт-Петербург) для количественного определения основных компонентов микробиоценоза, и выявления ДНК возбудителей протозойных инфекций (Lamblia Intestinalis Giardia, Dientamoeba fragilis, Isospora belli, Cryptosporidium parvum, Entamoeba histolytica) методом полимеразной цепной реакции.
2.9. Статистическая обработка результатов
На основании информации, полученной из опросников, в программе Microsoft Office Excel 2007 была сформирована база данных. Отношения шансов (OR) для предполагаемых факторов риска и другие биостатические показатели, рассчитывались при помощи пакета программ EpiInfo 7 и приложения StatCalc [wwwn.cdc.gov/epiinfo].
ГЛАВА 3. РЕЗУЛЬТАТЫ СОБСТВЕННЫХ ИССЛЕДОВАНИЙ
3.1. Сравнительная оценка санитарно-эпидемиологического благополучия в Чукотском автономном округе и Санкт-Петербурге
По острым кишечным инфекциям (далее ОКИ) эпидемиологическая ситуация в Российской Федерации остается напряженной. Как для Санкт-Петербурга, так и для Чукотского Автономного округа, заболеваемость острыми кишечными инфекциями неустановленной этиологии является актуальной патологией, показатель заболеваемости на этих административных территориях превышает показатель Российской Федерации (361,1 на 100 тыс. населения) в 1,7 раз в СПб и 1,3 раза в Чукотском автономном округе.
Доля острых кишечных инфекций неустановленной этиологии в структуре ОКИ в Санкт-Петербурге и Чукотском автономном округе составляет 73,4% [5] и 81,2% [8] соответственно. В 2014 году экономические потери страны только по данной нозологии составили порядка 12 млрд руб. [6].
Высокий уровень заболеваемости ОКИНЭ на Чукотском полуострове обусловлен низким уровнем санитарной грамотности населения, недостаточным обеспечением населения доброкачественной питьевой водой, соответствующей установленным санитарным нормам, в связи с неудовлетворительной очисткой и обеззараживанием воды, ветхости водозаборных сооружений и водопроводных сетей, использованием снега и льда для питьевых нужд [8].
По данным Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Чукотскому АО на территории ЧАО выявлено три наиболее неблагополучных в эпидемиологическом отношении территории по сумме острых кишечных инфекций: Чукотский район, Анадырский район, окружной центр – г. Анадырь. Чукотский район занял 1 место со средним многолетним уровнем по сумме ОКИ 1406,8 на 100 тыс. населения, 2 место занимает Анадырский район, где средний многолетний уровень составил 1320,4 на 100 тысяч населения. Третье место занимает окружной центр – г. Анадырь со средним многолетним уровнем по сумме ОКИ 919,7 [8].
В СПб Анализ территориального распределения ОКИ неустановленной этиологии свидетельствует об отсутствии единого пищевого или водного фактора передачи инфекции. К тому же в районах Санкт-Петербурга заболеваемость распределена крайне неравномерно [5].
Паразитарные заболевания. На долю гельминтозов в СПб приходится 59,2%, на протозоозы-40,8%. Показатель заболеваемости паразитарными заболеваниями в 2014 г. составил 206,9 на 100 тыс. населения, в 2013 г. 205,2 на 100 тыс. населения [5].
В ЧАО лидирующие позиции занимают гельминтозы- 98,8%, протозоозы составляют всего лишь 1,2%. Показатель заболеваемости паразитозами в 2014 году составил 244,7 на 100 тыс. населения, в 2013 г.-208,6 на 100 тыс. населения [8].
Пораженность детей паразитозами высокая как в Санкт-Петербурге, так и в Чукотском автономном округе. В СПб 84,6% от числа всех заболевших паразитозами - это дети до 17 лет [5], в ЧАО 94 % от числа всех заболевших - дети до14 лет [8].
В СПб в структуре гельминтозов контактные гельминтозы составляют 82,6%, геогельминтозы – 14,8% и биогельминтозы – 2,6%. Из редких паразитозов в 2014 г. зарегистрированы случаи заболеваний дипилидиозом, бластоцистозом. Среди зарегистрированных гельминтозов преобладает энтеробиоз и аскаридоз, среди протозоозов - лямблиоз [5].
На Чукотке в структуре гельминтозов ведущее место занимают контактные гельминтозы (энтеробиоз) – 52,4%, на биогельминтозы (дифиллоботриоз, эхинококкоз, описторхоз) – приходится 6,5%, на геогельминтозы (аскаридоз) - 4% [8].
Водоснабжение. Качество питьевой воды, подаваемой населению, определяется санитарным благополучием источников водоснабжения, качеством процесса водоподготовки, состоянием водопроводной сети.
Ниже приведены показатели, характеризующие состояние источников центрального хозяйственно-питьевого водоснабжения (поверхностных и подземных) в СПб и Чукотском АО.
Таблица № 3 - Доля проб воды источников централизованного хозяйственно-питьевого водоснабжения в СПб и ЧАО не соответствующих санитарно-гигиеническим нормативам.
Водоисточник
Микробиологические
Санитарно-химические


2013
2014
2013
2014

Все источники СПб
27,3
24,4
24,7
22,4

Поверхностные источники СПб
76,0
84,7
31,3
16,7

Подземные источники СПб
0
0
21,1
24,7

Все источники ЧАО
2,4
5,6
54,5
49,4

Поверхностные источники ЧАО
3,8
12,9
90,9
80,5

Подземные источники ЧАО
1,4
0
18,2
28,3


Так из таблицы видно, что поверхностные источники Санкт-Петербурга имеют высокую степень бактериальной обсемененности, что связано с возникновением свалок твердых бытовых отходов на прибрежных территориях водоемов, несанкционированных свалок от уборки улично-дорожной сети города [5]. До октября 2013 года сотни кубометров неочищенных стоков сбрасывались на водосборную территорию Ладожского озера. В настоящий момент в Санкт-Петербурге проходят обработку 98,5% сточных вод [11].
В ЧАО уровень бактериальной обсемененности поверхностных источников не столь высок. Однако на данной территории сбор стоков осуществляется в выгребные ямы, только от 10 населенных пунктов (21,7%) канализационные сточные воды отводятся централизованно. На всех выпусках стоков отсутствуют очистные сооружения [8]. Из 33 поверхностных и подземных источников централизованного водоснабжения 8 (24,2%) не отвечают санитарно-эпидемиологическим требованиям из-за отсутствия зон санитарной охраны [8].
Превышение удельного веса проб воды из поверхностных источников, неудовлетворительных по санитарно-химических показателям, в двух сравниваемых административных единицах связано с повышенным содержанием железа, что обусловлено природным составом воды [5, 8]. А в ЧАО еще и с пониженным содержанием фтора [8].
Высокий процент неудовлетворительных проб по санитарно-химических показателям воды из подземных источников в Санк-Петербурге продиктован повышенным содержанием марганца, железа и жесткостью природной воды [5].
Качество питьевой воды в распределительной сети на территории СПб и ЧАО имеет существенные различия. Информация об основных показателях, характеризующих состояние питьевой воды в распределительных сетях (таблица №4).



Таблица №4 - Доля проб воды из распределительной сети не отвечающих гигиеническим нормативам.
Водоисточник
Микробиологические
Санитарно-химические


2013
2014
2013
2014

Разводящая сеть в СПб
0,1
0
3,2
1,8

Разводящая сеть в ЧАО
1,5
0,76
52,3
51,2


Из результатов лабораторного контроля воды из распределительной сети известно, что в разводящей сети Санкт-Петербурга довольно низкий процент проб, неудовлетворительный по микробиологическим и санитано-химическим показателям.
В Чукотском автономном округе ситуация иная, и связана с отсутствием на водопроводах модульных установок очистки воды. Существующая технология обработки воды на большинстве водозаборных сооружений недостаточна и не обеспечивает удовлетворительное состояние воды по санитарно-химическим показателям перед поступлением в водопроводную и распределительную сеть. Ветхая водопроводная сеть, изношенность которой составляет более 60%, также отрицательно сказывается на качестве воды на Чукотском полуострове [8].
Состояние питьевой воды нецентрализованного хозяйственно-питьевого водоснабжения в Санкт-Петербурге удовлетворительное по микробиологическим и санитарно-химическим показателям [5]. Данных о состоянии питьевой воды нецентрализованного хозяйственно-питьевого водоснабжения в Чукотском автономном округе нет, в связи с чем сравнить их состояние невозможно.
Зимой прибрежные населенные пункты Чукотского моря обеспечиваются привозным снегом и льдом, малые реки и озера промерзают и обеспечить население централизованным водоснабжением не предоставляется возможным [8].
Таким образов, в СПб 100 % жителей получают доброкачественную питьевую воду [5]. Однако в ЧАО ситуация состоит иначе: доброкачественную питьевую воду для питьевых целей получает 51,2% населения, условно доброкачественную питьевую воду – (29,2%) и недоброкачественную питьевую воду –(19,5 %) [8].
Состояние пищевых продуктов, продовольственного сырья и питания населения. Показатели, характеризующие качество пищевой продукции приведены в Таблице №5.
Таблица №5 - Доля проб пищевых продуктов и продовольственного сырья, не соответствующих санитарно-гигиеническим нормам.
Показатели
2013
2014


ЧАО
СПб
РФ
ЧАО
СПб
РФ

Санитарно-химические
4,1
0,51
0,6
0
0,19
0,64

Физико-химические
-
0,64
3,94
3,3
3,46
-

Микробиологические
6,4
2,34
4,6
4,05
1,72
4,36

ГМО
0
0
0,07
0
0
0,14

Паразитологические
0
0
0,73
0
0,17
0,49

Антибиотики
0
0,86
0,34
0
0
0,48

Радиоактивные вещества
0
1,43
0,78
0
0
0,50


В 2013 году в ЧАО доля проб, не соответствующих санитарно-химическим показателям, превысила средний уровень по Российской Федерации в 6,8 раз, а по микробиологическим показателям - в 1,3 раза. В Санкт-Петербурге доля проб, где содержание антибиотиков не соответствует норме, выше, чем в среднем по стране в 2,5 раза, а по радиоактивным веществам - в 1,8 раз. В 2014 году удельный вес проб пищевых продуктов и продовольственного сырья на Чукотском полуострове и в Санкт-Петербурге, не соответствующих санитарно-гигиеническим нормам, не превышал среднероссийского.
Население Чукотки недостаточным образом обеспечено продовольственными товарами. Недостаточное обеспечение сел фруктам и овощами связано с отсутствием дорог, сложной транспортной схемой, отсутствием специальных овощехранилищ. Доставка авиатранспортом и морским путем таких продуктов, как кондитерских изделий, сыров, фруктов, колбас, увеличивает их стоимость на 300-400 руб., они становятся недоступными для малообеспеченного населения. В питании населения отчетливо прослеживается динамика увеличения потребления рыбы, мяса, фруктов, молочных продуктов и овощей, и уменьшении потребления хлеба, кондитерских изделий, сахара и жиров. Потребление населением овощей, в том числе картофеля, недостаточное. Фактическое потребление овощей составляет 79,3%, картофеля 40 % от нормы. У малоимущего населения основной рацион составляют макаронные изделия, рыба, хлеб, крупы, в населенных пунктах северного и восточного побережья Чукотского полуострова - мясо морских млекопитающих. В рационе населения преобладает потребление белка животного происхождения, что отвечает нормам питания для данного региона [8].
Население Санкт-Петербурга обеспечено продовольственными товарами в полной мере. Отмечается положительная тенденция потребления молока, картофеля, мяса, яиц, овощей, ягод, фруктов. Однако есть дефицит потребления картофеля, овощей, молока и молочных продуктов, ягод, фруктов, хлеба [5].


3.2. Характеристика обследованных больных
В исследовании факторов риска бластоцистной инвазии приняло участие 2 популяции. В первую популяцию вошли 248 беременных женщин, находившихся в Чаунской центральной районной больнице города Певек и в Чукотской окружной больнице города Анадырь на отделении акушерства и гинекологии, готовились к родам. Беременные из сел как правило приезжают в родильный дом заблаговременно, т.к. на Чукотке их всего несколько на весь округ и они имеют для них труднодоступность.
В зависимости от возраста все беременные были разделены на 3 группы (таблица №6)
Таблица №6 Распределение беременных женщин по возрасту
Возраст
Абсолютное количество
%

14-20 лет
31
12,5

20-30 лет
126
50,8

30 и старше
91
36,7

Всего
248
100


Из них превалирующее число было из сел (таблица№7)
Таблица №7 Распределение беременных женщин по территориальному принципу

Абсолютное количество
%

Город
85
34

Село
163
66


Вторую популяцию составили 345 пациентов кишечного отделения городской инфекционной больницы №30 им. С.П. Боткина города Санкт-Петербурга, поступивших в стационар с диагнозом острая кишечная инфекция неустановленной этиологии (далее Группа №7).
Из 345 согласилось заполнить анкеты только 195 человек. Таким образом в исследовании приняли участие 191 мужчина (97,91%) и 4 женщины (2,09%).
По возрасту пациенты распределились следующим образом (таблица №8):

Таблица №8 Распределение пациентов по возрасту с острой кишечной инфекцией неустановленной этиологии.
Возраст
Абсолютное количество
%

До 14 лет
1
1

14-20 лет
12
6

20-40 лет
108
57

40-60 лет
42
22

60 и старше
27
14


Большинство пациентов оказалось из Санкт-Петербуга (таблица№9)
Таблица №9 Распределение пациентов с острой кишечной инфекцией по территориальному принципу

Абсолютное количество
%

Санкт-Петербург
160
85

Другой город
29
15


3.3. Результаты обследования популяции ЧАО и СПб на бластоцистную инвазию.
Среди 248 беременных женщин у 27 была выявлена бластоцистная инвазия. Превалентность в популяции- 10,89 на 100 обследованных больных (95% ДИ 7,59-15,37).
В группе №1 было выявлено 14 случаев заражения Blastocystis spp., Превалентность на 100 обследованных составила - 10,29 на 100 обследованных больных (95% ДИ 6,23-16,53), в Группе №2 было выявлено 5 случаев, превалентность на 100 обследованных составила 7.81% (95% ДИ 3,38-17,02). В группе №3 из 19 обследованных - 4 инвазированых, что составило 21,05 на 100 обследованных (95% ДИ 8,51 – 43,33), в группе №4 выявлен 1 случай, превалентность на 100 обследованных составила - 7,69 (95% ДИ 1,37-33,31). В Группе №5 выявлено 3 случая, превалентность составила на 100 обследованных 15,38 (95% ДИ 4,32-42,23). Среди беременных группы №6 (Чаунский район), инвазированых обнаружено не было (таблица №10).

Таблица №10 - Результаты исследования превалентности бластоцистной инвазии в различных группах популяции беременных женщин ЧАО.
№ группы
Район
Превалентность на 100 обследованных
95% ДИ

1
Анадырский район
10,29
6,23-16,53

2
Чукотский район
7,81
3,38-17,02

3
Билибинский район
21,05
8,51 – 43,33

4
Провидеский район
7,69
1,37-33,31

5
Иультинский район
15,38
4,32-42,23

6
Чаунский район
0
0


Данные по превалентности бластоцистной инвазии в различных группах популяции беременных женщин представлены на рис.1.

Рис. 1. Превалентнось бластоцистной инвазии в различных группах популяции беременных женщин ЧАО.
Статистически значимых различий в сравниваемых группах не выявлено.
Анализ частоты выявления Blastocystis.spp в зависимости от возраста обнаружил, что чаще бластоцисты обнаруживаются в возрастной группе 14-20 лет и 20-30 лет (рис.2).
13 EMBED Excel.Chart.8 \s 1415

Рис. 2. Инвазированность бластоцистозом в различных возрастных группах популяции беременных женщин ЧАО.
Превалентность в городе составила 11,76 на 100 обследованных (95% ДИ 6,51-20,31), в селе -10,43 на 100 обследованных (95% ДИ 6,61-16,06). Показатель пораженности городского населения не имел статистически значимых различий с соответствующим показателем, определенным в сельской местности (рис.3).


Рис.3. Инвазированность бластоцистозом популяции беременных женщин ЧАО в зависимости от места проживания.
Во второй популяции среди 345 больных с гастроэнтероколитом неустановленной этиологии у 27 был установлен факт инфицирования Blastocystis spp..
Превалентность в этой группе составила 7.82 на 100 обследованных больных (95% ДИ 5,43-11,14).

Анализ частоты выявления Blastocystis.spp в зависимости от возраста обнаружил, что бластоцисты наиболее часто обнаруживаются в возрастной группе от 60 и выше (рис.4).

13 EMBED Excel.Chart.8 \s 1415
Рис.4. Инвазированность бластоцистозом в различных возрастных группах среди гастроэнтерологических больных неустановленной этиологии.
Превалентность в СПб составила 12,5 на 100 обследованных (95% ДИ 8,23-18,51),у жителей других городов - 17,24 на 100 обследованных (95% ДИ 7,59-34,54). Пораженность бластоцистами выше среди жителей других городов, а не СПб (рис.5).

Рис.5. Инвазированность среди больных с гастроэнтероколитом неустановленной этиологии в зависимости от места проживания.

3.4. Результаты генетического типирования.
В популяции беременных женщин в общей сложности на долю первого, второго и третьего субтипа пришлось по 18,5% (по 5 образцов) и в 44,5% установить принадлежность к субтипу, не удалось (12 образцов).


Рис. 6. Результаты генетического типирования Blastocystis spp в популяции беременных женщин ЧАО.
В группе амбулаторных пациентов с гастроэнтерологическими заболеваниями ST1 обнаружен в пяти образцах (18,52%), ST2 - в восьми образцах (29,63%) ST3 - в тринадцати образцах (48,15%). В одном образце идентифицировать генотип не удалось (3,70%).



Рис.7. Результаты генетического типирования Blastocystis spp в популяции больных с гастроэнтероколитом г.СПб
В общей сложности, на долю третьего субтипа пришлось 33,33%, второй и неопределенные составили по 24,07%, на долю первого субтипа пришлось 18,52%. Редкие субтипы выявить не удалось.

Рис.8.Результаты генетического типирования Blastocystis spp в двух исследуемых популяциях.

Секвенирование нуклеотидных последовательностей фрагментов SSUrDNA 8 штаммов Blastocystis sp. позволили подтвердить результаты ПЦР-типирования, совпадение по установленому субтипу произошло во всех восьми случаях. На полученной при выравнивании данных нуклеотидных последовательностей дендрограмме явно выделяются три кластера, соответствующие трем представленным субтипам. (рис.9 )
13 SHAPE \* MERGEFORMAT 1415
Рисунок . 9. Дендрограмма, характеризующая филогенетические взаимоотношения 8 штаммов бластоцист по результатам секвенирования фрагментов SSUrDNA. Использован метод максимального подобия.
3.5. Результаты исследования факторов риска.
Из 248 обследованных беременных женщин, у 27 был установлен факт инфицирования Blastocystis spp., что составило 10,8%. Из 221 неинфицированных пациентов, заполнивших опросники, была сформирована группа контролей. Соотношение случаи/контроли составило 1/8,1.
Расчет отношения шансов проводился для ряда предполагаемых факторов риска (социально-экономическое неблагополучие, миграция, наличие различных заболеваний, особенности питания и др.), результаты расчета приведены в таблице №11.









Таблица №11 - Результаты расчетов отношений шансов заражения бластоцистной инвазией в популяции ЧАО.

Фактор риска
Отношение шансов
95% ДИ

Возраст

14 – 20 лет
1,25
0,40-3,89

20 - 40 лет
0,69
0,24-1,96

40 и старше
2,79
0,28-27,86

По территориальному принципу

Выезд за пределы ЧАО
0,76
0,29-1,99

Коренной житель
0,98
0,42-2,31

Место жительства (село как фактор риска)
0,87
0,38-2,00

Социально-экономическое неблагополучие

Начальное образование
3,46
0,64-18,75

Неполное среднее
0,69
0,2-2,41


Среднее общее образование
0,59
0,23 – 1,53

Среднее специальное образование
0,95
0,41 – 2,23

Наличие высшего образования
0,94
0,38 – 2,33

Заболевания

Гепатит А
0


Гепатит В
0,56
0.71-4,50

Гепатит С
2,08
0,22-19,38

Гельминтозы
1,85
0,64-5,35

Туберкулез
0


Пневмония
0,38
0,04-2,98

Бронхиальная астма
4,17
0,36-47,62

ЗПППП
1,58
0,64-3,92

Хронические болезни
0,83
0,35-1,93

Питание

Изменилось питание за последние 5 лет
0,84
0,36-1,91

Увеличение потребления местных продуктов
1,10
0,48-2,48

Оленина
1,54
0,68-3,44

Жир морского зверя
0


Мясо морского зверя
0,62
0,14-2,80

Местная рыба
1,30
0,58-2,90

Овощи
0,67
0,28-1,60

Фрукты
0,91
0,40-2,05

Молоко
1,05
0,46-2,38

Грибы
0,38
0,11-1,33

Ягоды
1,01
0,45-2,29

Водоросли
0,73
0,09-5,92

Другие морепродукты
0,93
0,26-3,33



Из 345 обследованных пациентов, у 27 был установлен факт инфицирования Blastocystis spp.. При формировании группы случаев, было обнаружено, что двое из инфицированных пациентов отказались от заполнения опросника. Таким образом, в группу случаев вошло 25 пациентов. Среди 318 неинфицированных пациентов были заполнены опросники у 170 человек, которые и составили группу контролей. Соотношение случаи/контроли составило 1/6,8. Расчет отношения шансов проводился для ряда предполагаемых факторов риска (социально-экономическое неблагополучие, контакт с животными, употребление питьевой воды из ненадежных, в микробиологическом отношении источников, выезд за границу, наличие различных хронических заболеваний и др.), результаты расчета приведены в таблице №12.
Таблица №12 - Результаты расчетов отношений шансов заражения бластоцистной инвазией в популяции СПб.
Фактор риска
Отношение шансов
95% ДИ

Пол

Мужской
0,13
0,02 – 1,02

Женский
7,3
0,98 – 54,39

Возраст

14 – 20 лет
0,55
0,07 – 4,41

20 - 40 лет
0,71
0,30 – 1,65

40 -60 лет
1,50
0,58 – 3,87

Старше 60 лет
1,68
0,57 – 4,94

Социально-экономическое благополучие

Проживание в отдельной квартире
1,45
0,59 – 3,55

Проживание в коммунальной квартире
0,69
0,14 – 2,97

Отличные бытовые условия
1,23
0,49 – 3,04

Хорошие бытовые условия
1,30
0,56 – 3,03

Удовлетворительные бытовые условия
0,45
0,13 – 1,61

Проживает один
1,22
0,33 – 4,53

Проживает совместно с одним человеком
0,84
0,29 – 2,38

Проживает совместно с двумя людьми
0,58
0,18 – 1,78

Проживает совместно с тремя и более людьми
1,30
0,55 – 3,04

Незаконченное школьное образование
1,72
0,18 – 16,12

Среднее общее образование
1,77
0,72 – 4,30

Среднее специальное образование
0,84
0,34 – 2,06

Наличие высшего образования
0,49
0,16 – 1,52

Контакт с животными

Контакт с животными
1,10
0,48 – 2,56

Наличие домашних животных
1,28
0,55 – 2,98

Контакт с кошками
0,67
0,29 – 1,56

Контакт с собаками
0,65
0,26 – 1,60

Водный фактор

Употребление воды «из-под крана»
1,81
0,71 – 4,32

Употребление бутилированной воды
0,40
0,16 – 1,02

Употребление воды из колодца
0,40
0,11 – 1,41

Посещение бассейна
0,29
0,04 – 2,30

Посещение аквапарка
0,61
0,13 – 2,80

Посещение общественной бани
0,69
0,19 – 3,68

Туризм, миграция

Выезд за пределы РФ
1,03
0,36 – 2,96

Выезд за пределы Санкт-Петербурга
1,27
0,54 – 2,96

Наличие хронических заболеваний

Хронический вирусный гепатит
2,12
0,63 – 7,05

ВИЧ-инфекция
не выявлено случаев
-

Кожные заболевания (дерматозы) в анамнезе
23,04
2,29 – 231,33


При объединении двух исследуемых популяций (жители Чукотки и Санкт-Петербурга) в едином исследовании «случай-контроль» анализ был проведен по ряду факторов риска, предствленных в обоих опросниках для анкетирования (таблица 13). В результате, группу случаев составили 52 респондента, 391 человек составили группу контролей.
Таблица №13 Суммарные результаты расчетов отношений шансов заражения бластоцистной инвазией в популяции СПб и ЧАО.
Фактор риска
Отношение шансов
ДИ 95%

Возраст

14 – 20 лет
1,02
0,38-2,72

20 - 40 лет
0,68
0,37-1,26

40 и старше
1,70
0,86-3,37

Миграция

Выезд за пределы административной территории
0,85
0,46-1,58

Социально-экономическое благополучие

Незаконченное школьное образование
1,21
0,49-3,02

Среднее общее образование
1,05
0,56-1,97

Среднее специальное образование
1,00
0,54-1,85

Наличие высшего образования
0,78
0,39-1,58

Заболевания

Хронический вирусный гепатит
1,46
0,58-3,69

Кожные заболевания (дерматозы) в анамнезе
23,04
2,29 - 231,33


Из всех рассмотренных факторов риска, статистически значимое отношение шансов было получено для фактора – «кожные заболевания (дерматозы) в анамнезе», OR = 23,04 при 95% ДИ 2,29 - 231,33.
При анализе данных, предствленных в таблице №13 обращает на себя внимание тенденция к увеличению показателя отношения шансов при снижении уровня образования, что может быть связано с различиями в уровнях санитарной культуры населения с различным уровнем образования.

3.7. Определение основных компонентов кишечной микробиоты с использованием тест-систем «Колонофлор-16» и «Прото-скрин».
При оценке паразитофауны кишечника исследуемых, инвазированных бластоцистозом, отмечены ассоциации разных видов простейших: двухчленные ассоциации бластоцисты-Dientamoeba fragilis (4 случая); бластоцисты-лямблии (1 случай), трехчленные ассоциации бластоцисты-Dientamoeba fragilis-Isospora belli (1 случай). Однако среди обследованных преобладала моноинвазия Blastocystis spp..
В 88% случаев, бластоцистной инвазии сопутствовали признаки дисбиотических процессов. Обращает на себя внимание, распространенность энтеропатогенных вариантов Esherichia coli (у 56% обследованных лиц). Реже встречались Staphylococcus aureus (16%) и Candida sp. (12%).





ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ ИССЛЕДОВАНИЙ
В нашей работе выявлена относительно высокая превалентность бластоцистной инвазии не только в популяции пациентов с ОКИНЭ, но также и в популяции относительно здоровых жителей Чукотского региона. Исследования, проводимые в рамках настоящей работы были сфокусированы на изучении факторов риска бластоцистоза, указывающих на возможность реализации различных путей передачи этого заболевания. Несмотря на отмечавшуюся ранее возможность передачи возбудителя водным путем в настоящем исследовании мы не получили фактов, подтверждающих данное предположение.
В частности, сравнение уровней пораженности бластоцистозом в регионах существенно отличающихся по уровню коммунального благоустройства и обеспеченности населения доброкачественной питьевой водой не позволило выявить статистически значимых различий между этими показателями. Кроме того, в исследовании «случай-контроль» нам не удалось выявить связи с факторами риска, определяемыми водным фактором. В частности, не выявлено связи с такими факторами как «употребление воды из-под крана», «посещение бассейнов, аквапарков, бань», отсутствует достоверная связь с перенесенным гепатитом А (инфекция, которая нередко передается водным путем и формирует «водные» эпидемии).
Еще одной проверяемой нами гипотезой являлось предположение о связи бластоцистной инвазии с отдельными продуктами питания, которые в связи с особенностями рациона питания жителей Чукотского полуострова нередко употребляются без термической обработки или с минимальной термической обработкой (оленина, жир и мясо морского зверя, рыба), Однако, эта гипотеза также не подтвердилась.
Не выявлено статистически значимых различий в показателях превалентности между жителями городов Чукотского АО и сельской местности. Вероятно, риск заражения бластоцистозом жителей Чукотки не зависит от места проживания. Данное обстоятельство может быть интерпретировано в пользу предположения о том, что питьевая вода в данном регионе не является существенным фактором передачи Blastocystis sp.
Существенный интерес представляет выявленная тенденция к увеличению показателя отношения шансов при снижении уровня образования, что может указывать на значимость уровня санитарной культуры респондентов с различным уровнем образования в качестве фактора риска инфицирования бластоцистами. Данный факт косвенно указывает на возможность реализации контактно-бытового пути передачи, эффективность которой существенно зависит от уровня санитарной культуры.
В ходе исследования был изучен ряд биологических факторов риска, в частности возраст исследуемых лиц, а также ряд сопутствующих заболеваний.
В результате выявлена взаимосвязь между возрастом и заболеваемостью клинически выраженными формами бластоцистной инвазии: показано, что с увеличением возраста больных острыми кишечными инфекциями увеличивается частота идентификации бластоцист. В то же время, данная закономерность не наблюдается в отношении носителей из числа жителей Чукотки. Для объяснения выявленной закономерности можно предположить несколько гипотез. Во-первых, указанное возрастное распределение случаев может определяться хроническим характером заболевания с длительным (многолетним) инкубационным периодом. Во-вторых, возможно, что определенные возрастные изменения в функциональном состоянии желудочно-кишечного тракта, либо сопутствующие хронические заболевания, заболеваемость которыми увеличивается с возрастом, являются факторами, способствующими переходу латентной инфекции в фазу обострения.
Одной из групп заболеваний, имеющих предполагаемую связь с бластоцистозом, является группа хронических вирусных гепатитов B и С (OR=2,12, ДИ=0,63 – 7,05). В настоящем исследовании ввиду небольшого количества респондентов, страдающих вирусными гепатитами, нам не удалось получить убедительых доказателств связи между этими состояниями. Однако, такая связь представляется весьма вероятной, как было показано в предыдущих исследованиях [14]. В работе А.С. Сигидаева [14] также указывалось на возможную связь бластоцистоза и дисбиотических состояний, возникающих у пациентов с хроническими вирусными гепатитами.
Связь бластоцистной инвазии с дисбиотическими изменениями отмечалась также в нескольких публикациях [2, 4]. В исследовании Глебовой Н.С. у пациентов, страдающих бластоцистозом, увеличено содержание транзиторной и факультативной микрофлоры (клостридии, клебсиеллы, грибов рода Candida) и снижена облигатная микрофлора кишечника (лактобактерии, типичные эшерихии и бифидобактерии), появились золотистый стафилококк и патогенная кишечная палочка [4]. Увеличение представителей условно-патогенных микроорганизмов (стафилококки, клебсиеллы, энтерококки) и уменьшение нормальной микрофлоры (бифидобактерии, лактобактерии, бактероиды) было отмечено в работе Бугеро Н.В и соавторов [2].
Наша работа подтверждает значимость развития бластоцистоза как фактора, ассоциированного с дисбиозом кишечника. При оценке состава микробиоты с использованием тест-системы «Колонофлор-16» отмечается сниженное количество лактобактерий, бифидумбактерий, бактероидов и увеличенное количество энтеробактер и нормальной кишечной палочки. Обращает на себя внимание, распространенность энтеропатогенных вариантов Esherichia coli (у 56% обследованных лиц), Staphylococcus aureus (у 16%) и Candida sp. (у 12%).
Из числа рассмотренных нами факторов риска статистически значимое отношение шансов получено для фактора – «кожные заболевания (дерматозы) в анамнезе», (OR = 23,04 при 95% ДИ (2,29 – 231,33)). На сегодняшний день остаются невыясненными патогенетические механизмы, возникновения кожных заболеваний у лиц с бластоцистной инвазией, однако, полученные данные позволяют рассматривать пациентов с дерматологической патологией в качестве группы риска для заболеваний бластоцистозом и возможного резервуара данной инвазии.
Результаты молекулярно-генетического субтипирования бластоцист, циркулирующих как в Санкт-Петербурге, так и на Чукотке показали, что ряд субтипов является глобально распространенными. Показано, что в структуре возбудителей бластоцистной инвазий в обоих регионах ST1, ST2, ST3 занимают существенную долю. В общей сложности, на долю третьего субтипа пришлось 33,33%, второго - 24,07%, на долю первого субтипа пришлось 18,52%. В то же время отмечены региональные особенности, определяющие структуру субтипов бластоцист. В частности, существенную долю бластоцист, ДНК которых была выявлена в материале от жителей Чукотки, не представлялось возможным отнести ни к одному из перечисленных субтипов, что, с нашей точки зрения, требует дальнейших углубленных исследований
ВЫВОДЫ:
Несмотря на выявленные в Санкт-Петербурге и Чукотском автономном округе существенные различия в уровнях коммунального благоустройства, обеспеченности населения доброкачественной питьевой водой и продуктами питания, пораженность населения бластоцистной инвазией по данным проведенных поперечных исследований существенно не различается в сравниваемых регионах. Превалентность среди относительно здоровых беременных женщин ЧАО составила 10,89 на 100 обследованных больных (95% ДИ 7,59-15,37), среди больных ОКИНЭ в СПБ - 7.82 на 100 обследованных больных (95% ДИ 5,43-11,14).
В Санкт-Петербурге и Чукотском автономном округе доминируют субтипы бластоцист ST1, ST2, ST3. При изучении генетической структуры возбудителя бластоцистоза в Чукотском АО обращает на себя внимание высокая доля ДНК нетипируемых штаммов Blastocystis sp.
Исследование, проведенное по дизайну случай-контроль, позволило установить ассоциацию бластоцистоза с наличием заболеваний кожи в анамнезе», (OR = 23,04 при 95% ДИ (2,29 – 231,33)). .
Бластоцистная инвазия у большинства обследованных лиц из числа бессимптомных носителей сопровождалась изменением состава микробиоты кишечника, в частности с увеличением Esherichia coli (у 56% обследованных лиц), Staphylococcus aureus (у 16%) и Candida sp. (у 12%). В 88% случаев выявлены дисбиотические изменения, сопровождающиеся снижением количества лактобактерий, бифидумбактерий, бактероидов и увеличением количества энтеробактер и кишечной палочки.

СПИСОК СОКРАЩЕНИЙ
ДИ – доверительный интервал
ДНК- дезоксирибонуклеиновая кислота
НЯК- неспецифический язвенный колит
ОКИ - острые кишечные инфекции
ОКИНЭ - острые кишечные инфекции неустановленной этиологии
ПЦР -полимеразная цепная реакция
РНК - рибонуклеиновая кислота
СПб - Санкт-Петербург
СРК - синдром раздраженного кишечника
ЧАО - Чукотский автономный округ
OR - отношение шансов













СПИСОК ЛИТЕРАТУРЫ

Белова Л. М. Blastocystis anseri ( Protista:Rhizopoda) из домашних гусей //Паразитолог  //Паразитология. – 1992. – вып.1. – С. 80-83.
Бугеро Н. В., Немова И. С., Потатуркина-нестерова Н. И. Факторы персистенции простейших фекальной флоры при дисбиозе кишечника //Вестник новых медицинских технологий. – 2011. – Т. 18. – №. 3.
Бугеро Н. В., Потатуркина-Нестерова Н. И. Результаты определения вирулентности Blastocystis spp. Методом рестрикционного анализа ДНК простейших //Фундаментальные исследования. – 2012. – №. 11-5.
Глебова Н. С. Изменения микробиоценоза кишечника под влиянием дестабилизирующего действия бластоцистной инвазии //Вестник Оренбургского государственного университета. – 2007. – №. 5.
Государственный доклад «О состоянии санитарно-эпидемиологического благополучия населения в Санкт-Петербурге» в 2014 году  [Электронный ресурс]. Режим доступа URL:[ Cкачайте файл, чтобы посмотреть ссылку ]
Государственный доклад «О состоянии санитарно-эпидемиологического благополучия населения в Российской Федерации в 2014 году»  [Электронный ресурс]. Режим доступа URL:[ Cкачайте файл, чтобы посмотреть ссылку ]
Коза, Н.М. Распространение кишечных протозоозов среди населения крупного города / Н.М. Коза, В.И. Сергевнин, Л.Я. Горбань // Материалы VIII Всерос. съезда эпидемиологов, микробиологов и паразитологов. М. : ООО «Росинекс», 2002. – Т. 1. – С. 339–340.
Материалы для государственного доклада «О состоянии санитарно-эпидемиологического благополучия населения в Чукотском автономном округе в 2014 году» [Электронный ресурс]. Режим доступа URL: [ Cкачайте файл, чтобы посмотреть ссылку ]
МУК 4.2.3145-13 4.2 Методы контроля. Биологические и микробиологические факторы. Лабораторная диагностика гельминтозов и протозоозов.
Нестеров А. С. Особенности патогенеза и терапии хронических дерматозов при бластоцистной инвазии. дис. дмн //Ульяновск–2009. – 2009.
Официальный сайт ГУП «Водоканал Санкт-Петербурга». Цифры и факты. [Электронный ресурс]. Режим доступа URL: http: //www.vodokanal.spb.ru/o_kompanii/cifry_i_fakty/
Продеус Т.В., Федянкина Л.В., Фролова А.А. Морфологическая идентификация бластоцист // Медицинская паразитология и паразитарные болезни.  – 2014. – №. 1. – С. 9-13.
Сигидаев А.С. и др. Лабораторная характеристика бластоцистной инвазии у больных с хроническим вирусным гепатитами. //  Журнал инфектологии – 2011. – Т.3, №4 – С. 62 – 66.
Сигидаев А.С. Клинико-лабораторная характеристика бластоцистной инвазии у больных HCV-инфекцией, дисс. на соиск. ст. к.м.н., Санкт-Петербург-2012, 116 с.
Старостина, О.Ю. Распространенность паразитических инвазий у городских жителей / О.Ю. Старостина, С.П. Запарий, Л.М. Толмачева // Материалы VIII Всерос. съезда эпидемиологов, микробиологов и паразитологов. – М.: ООО «Росинекс», 2002. – Т. 1. – С. 403–404.
Arisue, N. et al. (2002) Phylogenetic position of Blastocystis hominis and of Stramenopiles inferred from multiple sequence data.// Journal of Eukaryotic Microbiology. – 2002. – Т. 49. – №. 1. – С. 42-53.
Armentia A. et al. Urticaria by Blastocystis hominis. Successful treatment with paromomycin //Allergologia et immunopathologia. – 1992. – Т. 21. – №. 4. – С. 149-151.
Babb R. R., Wagener S. Blastocystis hominis--a potential intestinal pathogen //Western Journal of Medicine. – 1989. – Т. 151. – №. 5. – С. 518.
Bбlint A. et al. Do not forget the stool examination!cutaneous and gastrointestinal manifestations of Blastocystis sp. infection //Parasitology research. – 2014. – Т. 113. – №. 4. – С. 1585-1590.
Boeck W. C., Drbohlav J. The cultivation of Endamoeba histolytica //American Journal of Epidemiology. – 1925. – Т. 5. – №. 4. – С. 371-407.
BцhmGloning B., Knobloch J., Walderich B. Five subgroups of Blastocystis hominis isolates from symptomatic and asymptomatic patients revealed by restriction site analysis of PCRamplified 16Slike rDNA //Tropical Medicine & International Health. – 1997. – Т. 2. – №. 8. – С. 771-778.
Boorom K. F. et al. Oh my aching gut: irritable bowel syndrome, Blastocystis, and asymptomatic infection //Parasites & Vectors. – 2008. – Т. 1. – №. 1. – С. 1-16.
Brites C. et al. Blastocystis hominis as a Potential Cause of Diarrhea in AIDS Patients: a Report of Six Cases in Bahia, Brazil //The Brazilian journal of infectious diseases: an official publication of the Brazilian Society of Infectious Diseases. – 1997. – Т. 1. – №. 2. – С. 91-94.
Brumpt E. Blastocystis hominis n. sp. et formes voisines //Bull Soc Pathol Exot. – 1912. – Т. 5. – С. 725-730.
Coyle C. M. et al. Blastocystis: to treat or not to treat //Clinical infectious diseases. – 2011. – С. cir810.
Danchaivijitr S. et al. Prevalence and effectiveness of an education program on intestinal pathogens in food handlers //J Med Assoc Thai. – 2005. – Т. 88. – №. Supl 10. – С. S31-S35.
Doyle P. W. et al. Epidemiology and pathogenicity of Blastocystis hominis //Journal of Clinical Microbiology. – 1990. – Т. 28. – №. 1. – С. 116-121.
El-Shazly A. M. et al. Blastocystis hominis among symptomatic and asymptomatic individuals in Talkha Center, Dakahlia Governorate, Egypt //Journal of the Egyptian Society of Parasitology. – 2005. – Т. 35. – №. 2. – С. 653-666.
Garavelli P. Blastocystis: a new discase in the acquired immundeficiency syndrоm / P. Garavelli // Int. S. STD. AIDS. - 1990. - P.134-135.
Garavelli P.L. Endoscopy of blastocystosis (Zierdt-Garavelli Disease) / P.L. Garavelli, L. Scaglione, A. Merighi, M. Libanore // Italian Journal of Gastroenterology. - 1992. - Vol.24. - P.206.
Giacometti A. et al. Irritable bowel syndrome in patients with Blastocystis hominis infection //European Journal of Clinical Microbiology and Infectious Diseases. – 1999. – Т. 18. – №. 6. – С. 436-439.
Gladman D. D. et al. Clinical and genetic registries in psoriatic disease //The Journal of rheumatology. – 2008. – Т. 35. – №. 7. – С. 1458-1463.
Guignard S. et al. Prevalence of enteroparasites in a residence for children in the Cordoba Province, Argentina //European journal of epidemiology. – 2000. – Т. 16. – №. 3. – С. 287-293.
Hameed D. M. A., Hassanin O. M., Zuel-Fakkar N. M. Association of Blastocystis hominis genetic subtypes with urticaria //Parasitology research. – 2011. – Т. 108. – №. 3. – С. 553-560.
Jones W. R. The experimental infection of rats with Entamoeba histolytica; with a method for evaluating the anti-amoebic properties of new compounds //Annals of Tropical Medicine & Parasitology. – 1946. – Т. 40. – №. 2. – С. 130-140.
Katsarou-Katsari A. et al. Acute urticaria associated with amoeboid forms of Blastocystis sp. subtype 3 //Acta dermato-venereologica. – 2008. – Т. 88. – №. 1. – С. 80-81.
Kaya S. et al. Pathogenicity of Blastocystis hominis, a clinical reevaluation //Turkiye Parazitol Derg. – 2007. – Т. 31. – №. 3. – С. 184-7.
Khan Z. A., Alkhalife I. S. Prevalence of Blastocystis hominis among" healthy" food handlers in Dammam, Saudi Arabia //Journal of the Egyptian Society of Parasitology. – 2005. – Т. 35. – №. 2. – С. 395-401.
Kurniawan A. et al. Intestinal parasitic infections in HIV/AIDS patients presenting with diarrhoea in Jakarta, Indonesia //Transactions of the Royal Society of Tropical Medicine and Hygiene. – 2009. – Т. 103. – №. 9. – С. 892-898.
Li L. H. et al. Cross-sectional surveys and subtype classification of human Blastocystis isolates from four epidemiological settings in China //Parasitology research. – 2007. – Т. 102. – №. 1. – С. 83-90.
Luke
· J. et al. Are human intestinal eukaryotes beneficial or commensals? //PLoS Pathog. – 2015. – Т. 11. – №. 8. – С. e1005039.
Menounos P. G. et al. Direct detection of Blastocystis sp. in human faecal samples and subtype assignment using single strand conformational polymorphism and sequencing //Molecular and cellular probes. – 2008. – Т. 22. – №. 1. – С. 24-29.
Micheloud D. et al. [Chronic angioedema and blastocystis hominis infection] //Revista de gastroenterologia del Peru: organo oficial de la Sociedad de Gastroenterologia del Peru. – 2006. – Т. 27. – №. 2. – С. 191-193.
Moe K. T. et al. Development of Blastocystis hominis cysts into vacuolar forms in vitro //Parasitology research. – 1999. – Т. 85. – №. 2. – С. 103-108.
Moe K. T. et al. Observations on the ultrastructure and viability of the cystic stage of Blastocystis hominis from human feces //Parasitology research. – 1996. – Т. 82. – №. 5. – С. 439-444.
Nourrisson C. et al. Blastocystis is associated with decrease of fecal microbiota protective bacteria: comparative analysis between patients with irritable bowel syndrome and control subjects //PloS one. – 2014. – Т. 9. – №. 11. – С. e111868.
Ozcakir O. et al. Characteristics of Blastocystis hominis infection in a Turkish university hospital //Turkiye parazitolojii dergisi/Turkiye Parazitoloji Dernegi= Acta parasitologica Turcica/Turkish Society for Parasitology. – 2006. – Т. 31. – №. 4. – С. 277-282.
Цzyurt M. et al. Molecular epidemiology of Blastocystis infections in Turkey //Parasitology international. – 2008. – Т. 57. – №. 3. – С. 300-306.
Parkar U. et al. Direct characterization of Blastocystis from faeces by PCR and evidence of zoonotic potential //Parasitology. – 2007. – Т. 134. – №. 03. – С. 359-367.
Salim H. R. et al. Blastocystis in animal handlers //Parasitology research. – 1999. – Т. 85. – №. 12. – С. 1032-1033.
Scicluna S. M., Tawari B., Clark C. G. DNA barcoding of Blastocystis //Protist. – 2006. – Т. 157. – №. 1. – С. 77-85.
Silberman J. D. et al. Human parasite finds taxonomic home //Nature. – 1996. – Т. 380. – №. 6573. – С. 398-398.
Singh M. et al. Axenic culture of reptilian Blastocystis isolates in monophasic medium and speciation by karyotypic typing //Parasitology research. – 1996. – Т. 82. – №. 2. – С. 165-169.
Stensvold C. R. Comparison of sequencing (barcode region) and STS PCR for Blastocystis subtyping //Journal of clinical microbiology. – 2012. – С. JCM. 02541-12.
Stensvold C. R. et al. Detecting Blastocystis using parasitologic and DNA-based methods: a comparative study //Diagnostic microbiology and infectious disease. – 2007. – Т. 59. – №. 3. – С. 303-307.
Stensvold C. R. et al. Pursuing the clinical significance of Blastocystis–diagnostic limitations //Trends in parasitology. – 2009. – Т. 25. – №. 1. – С. 23-29.
Stensvold C. R. et al. Terminology for Blastocystis subtypes–a consensus //Trends in parasitology. – 2007. – Т. 23. – №. 3. – С. 93-96.
Stensvold R. et al. Detection of Blastocystis hominis in unpreserved stool specimens by using polymerase chain reaction //Journal of Parasitology. – 2006. – Т. 92. – №. 5. – С. 1081-1087.
Stenzel D. J., Boreham P. F. Blastocystis hominis revisited //Clinical Microbiology Reviews. – 1996. – Т. 9. – №. 4. – С. 563-584.
Stenzel D. J., Cassidy M. F., Boreham P. F. L. Morphology of Blastocystis sp. from domestic birds //Parasitology research. – 1994. – Т. 80. – №. 2. – С. 131-137.
Stenzel D. J., Lee M. G., Boreham P. F. L. Morphological differences in Blastocystiscysts–an indication of different species? //Parasitology research. – 1997. – Т. 83. – №. 5. – С. 452-457.
Taamasri P. et al. Transmission of intestinal blastocystosis related to the quality of drinking water //Southeast Asian journal of tropical medicine and public health. – 2000. – Т. 31. – №. 1. – С. 112-117.
Tan K. S. W. et al. Current views on the clinical relevance of Blastocystis spp //Current infectious disease reports. – 2010. – Т. 12. – №. 1. – С. 28-35.
Tan K. S. W. New insights on classification, identification, and clinical relevance of Blastocystis spp //Clinical Microbiology Reviews. – 2008. – Т. 21. – №. 4. – С. 639-665.
Termmathurapoj S. et al. The usefulness of short-term in vitro cultivation for the detection and molecular study of Blastocystis hominis in stool specimens //Parasitology research. – 2004. – Т. 93. – №. 6. – С. 445-447.
Valsecchi R., Leghissa P., Greco V. Cutaneous lesions in Blastocystis hominis infection //Acta dermato-venereologica. – 2004. – Т. 84. – №. 4. – С. 322-323.
Villalobos G. et al. Suitability of internal transcribed spacers (ITS) as markers for the population genetic structure of Blastocystis spp //Parasit Vectors. – 2014. – Т. 7. – №. 1. – С. 461.
Wong K. H. S. et al. Predominance of subtype 3 among Blastocystis isolates from a major hospital in Singapore //Parasitology research. – 2008. – Т. 102. – №. 4. – С. 663-670.
Yakoob J. et al. Irritable bowel syndrome: in search of an etiology: role of Blastocystis hominis //The American journal of tropical medicine and hygiene. – 2004. – Т. 70. – №. 4. – С. 383-385.
Yoshikawa H. et al. Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries //Parasitology research. – 2004. – Т. 92. – №. 1. – С. 22-29.
Yoshikawa H. et al. Ultrastructural and phylogenetic studies on Blastocystis isolates from cockroaches //Journal of Eukaryotic Microbiology. – 2007. – Т. 54. – №. 1. – С. 33-37.
Zaman V., Howe J., Ng M. Variation in the cyst morphology of Blastocystis hominis //Parasitology research. – 1997. – Т. 83. – №. 3. – С. 306-308.
Zierdt C. H. Blastocystis hominis--past and future //Clinical Microbiology Reviews. – 1991. – Т. 4. – №. 1. – С. 61-79.
Zierdt C. H., Nagy B. Antibody response to Blastocystis hominis infections //Annals of internal medicine. – 1993. – Т. 118. – №. 12. – С. 985.
ZuelFakkar N. M., Abdel Hameed D. M., Hassanin O. M. Study of Blastocystis hominis isolates in urticaria: a case–control study //Clinical and experimental dermatology. – 2011. – Т. 36. – №. 8. – С. 908-910.










13 PAGE \* MERGEFORMAT 14215





·
·
·
·
·
·
·
·
·оДиаграмма 1

Приложенные файлы

  • doc 7028678
    Размер файла: 679 kB Загрузок: 0

Добавить комментарий